SubtiBank SubtiBank
ypuC/1
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypuC/1

part of the ypuC pseudogene
locus
BSU_23329
pI
0.00
mw
0.00 kDa
protein length
gene length
255 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    2,433,631 2,433,885

    Expression and Regulation

    Operons

    genes
    [gene|BD57DC17917E229BD315C56A6726C8235E77311B|ypuB]-[gene|8C3F29CD95F72D29A00240C305689117D94876E9|ypuC/1]-[gene|E635BA05792D1FEEC9710F197F7231E5CAC71737|ypuC/2]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    genes
    [gene|BD57DC17917E229BD315C56A6726C8235E77311B|ypuB]-[gene|8C3F29CD95F72D29A00240C305689117D94876E9|ypuC/1]
    description
    [Pubmed|10482513]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed under stress conditions ([protein|search|SigB]) [Pubmed|10482513]
  • view in new tab

    Biological materials

    Mutant

  • BKE23329 ([gene|8C3F29CD95F72D29A00240C305689117D94876E9|ypuC/1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23329 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAATGACAAATGCCGTTAA, downstream forward: _UP4_TAGTATGTAATCAAAATTAA
  • BKK23329 ([gene|8C3F29CD95F72D29A00240C305689117D94876E9|ypuC/1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23329 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAATGACAAATGCCGTTAA, downstream forward: _UP4_TAGTATGTAATCAAAATTAA
  • References

  • 10482513