SubtiBank SubtiBank
yplQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yplQ

similar to hemolysin III
locus
BSU21790
pI
9.55
mw
23.44 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.4|Lifestyles/ miscellaneous]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,295,302 2,295,943

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|90C747D6D6194608C2CF9566F1740A6B20966A11|yplP]-[gene|8C382ECBEE4E2911E0233E0882BEA754156B9D40|yplQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B269 (yplQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1268 NBRP B. subtilis, Japan]
  • BKE21790 ([gene|8C382ECBEE4E2911E0233E0882BEA754156B9D40|yplQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTACATTCTCCTTTCGA, downstream forward: _UP4_TAACAGTAACAGAAAAGCGC
  • BKK21790 ([gene|8C382ECBEE4E2911E0233E0882BEA754156B9D40|yplQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTACATTCTCCTTTCGA, downstream forward: _UP4_TAACAGTAACAGAAAAGCGC