SubtiBank SubtiBank
yplQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yplQ

similar to hemolysin III
locus
BSU_21790
pI
9.55
mw
23.44 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.4|Lifestyles/ miscellaneous]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,295,302 2,295,943

    The protein

    Protein family

  • UPF0073 (Hly-III) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|90C747D6D6194608C2CF9566F1740A6B20966A11|yplP]-[gene|8C382ECBEE4E2911E0233E0882BEA754156B9D40|yplQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B269 (yplQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1268 NBRP B. subtilis, Japan]
  • BKE21790 ([gene|8C382ECBEE4E2911E0233E0882BEA754156B9D40|yplQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTACATTCTCCTTTCGA, downstream forward: _UP4_TAACAGTAACAGAAAAGCGC
  • BKK21790 ([gene|8C382ECBEE4E2911E0233E0882BEA754156B9D40|yplQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTACATTCTCCTTTCGA, downstream forward: _UP4_TAACAGTAACAGAAAAGCGC