SubtiBank SubtiBank
ctaG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ctaG

formation of functional cytochrome C-oxidase (caa3)
locus
BSU_14930
pI
6.58
mw
33.92 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
formation of functional cytochrome C-oxidase (caa3)
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.1|Terminal oxidases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.1|Protein maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,564,422 1,565,315

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|83F5D5FCCAFADB7231ACD9BE7941820240954C70|ctaB]-[gene|72D5442C0EF3B404F7B615366E357B68C863CEB6|ctaC]-[gene|20D1174554A03EECE233A1A045F6DF83AF799959|ctaD]-[gene|9DF8423F1D63ED3928B2818F58BC3DECCDBB1DDB|ctaE]-[gene|28E5AF86CE49D7B0ECBFAF9ED5C1FC65D9F810EA|ctaF]-[gene|8C16E115CB59A74C24954BFCDE112720BA09D5EA|ctaG]
    description
    [Pubmed|9829923]

    regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|9829923], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, synergistic repression with [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, synergistic repression with [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|9829923]
  • view in new tab

    Biological materials

    Mutant

  • BKE14930 ([gene|8C16E115CB59A74C24954BFCDE112720BA09D5EA|ctaG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCACCTCCGGCGG, downstream forward: _UP4_TAAAAGGTACAGCGAAATAT
  • BKK14930 ([gene|8C16E115CB59A74C24954BFCDE112720BA09D5EA|ctaG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCACCTCCGGCGG, downstream forward: _UP4_TAAAAGGTACAGCGAAATAT
  • References

  • 14766920,9829923,20817675