SubtiBank SubtiBank
rpmF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rpmF

ribosomal protein
locus
BSU_15080
pI
10.77
mw
6.59 kDa
protein length
gene length
180 bp Sequence Blast
function
translation
product
ribosomal protein L32
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    1,575,804 1,575,983

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bL32 family (single member, according to UniProt)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation

    Operons

    genes
    [gene|AF4BB5F08F805D3621597559B4C7F53A1A1CAD05|ylbN]-[gene|8C16300FC29E7DB5070367C8A2568134AF528233|rpmF]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • view in new tab

    Biological materials

    Mutant

  • BKE15080 ([gene|8C16300FC29E7DB5070367C8A2568134AF528233|rpmF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTCCCACCTCCTTAA, downstream forward: _UP4_TAATGAGAAAAGCGCAGGGT
  • BKK15080 ([gene|8C16300FC29E7DB5070367C8A2568134AF528233|rpmF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTCCCACCTCCTTAA, downstream forward: _UP4_TAATGAGAAAAGCGCAGGGT
  • References

  • 19653700,22383849,11948165,23002217,23033921,25903689