SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[SW|ABC transporter ](ATP-binding protein) ([protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE]-[protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX]), required for [protein|search|CwlO ]activity (cell elongation) and for proper activation of [protein|search|Spo0A ]and initiation of [SW|sporulation]
25.47 kDa
protein length
228 aa Sequence Blast
gene length
687 bp Sequence Blast
control of [SW|cell wall synthesis]
[SW|ABC transporter ](ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Autolytic activity required for peptidoglycan synthesis (cell elongation)]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Regulatory ABC transporters]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,624,821 3,625,507

    Phenotypes of a mutant

  • a ''[gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]'' mutation is synthetically lethal with a ''[gene|321F248C22D7283C0F3323F1F4069E36F8D7FE6C|lytE]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]
  • shorter, fatter cells, this can be rescued by addition of Mg(2+) [Pubmed|23869552,23855774]
  • reduced growth rate, especially at low Mg(2+) concentrations [Pubmed|23869552]
  • The protein

    Catalyzed reaction/ biological activity

  • necessary for the autolysin activity of [protein|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|CwlO] [Pubmed|23855774]
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|YknY], [protein|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|YtrE], [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|YxdL], [protein|464DD1855E6B3195EE242637612A16C73FF32FC0|PsdA], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 2-227) (according to UniProt)
  • Structure

  • [PDB|3TIF] (ATP-binding protein from ''Methanococcus jannaschii'', 40% identity) [Pubmed|22158619]
  • [SW|Localization]

  • membrane associated (via [protein|E22D0F0AC56DC95AFC02E7F55FCD5FAA44B6B490|FtsX]) [Pubmed|18573177]
  • Expression and Regulation


    (according to [ DBTBS]) null

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials


  • BKE35260 ([gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATCACCTAATCTTT, downstream forward: _UP4_GAGTCAAGAGGGGAGTATGG
  • BKK35260 ([gene|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|ftsE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAATCACCTAATCTTT, downstream forward: _UP4_GAGTCAAGAGGGGAGTATGG
  • References

  • 10092453,18573177,22158619,14651647,23855774,23869552