SubtiBank SubtiBank
panC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

panC

pantothenate synthase
locus
BSU22420
pI
4.63
mw
31.81 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast
function
biosynthesis of coenzyme A
product
pantothenate synthase
essential
no
ec
6.3.2.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.4|Biosynthesis of coenzyme A]
  • Gene

    Coordinates
    2,352,977 2,353,837

    The protein

    Catalyzed reaction/ biological activity

  • ATP + (R)-pantoate + beta-alanine = AMP + diphosphate + (R)-pantothenate (according to Swiss-Prot)
  • Protein family

  • pantothenate synthetase family (according to Swiss-Prot)
  • Structure

  • [PDB|2EJC] (from ''Thermotoga maritima'', 50% identity, 66% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE22420 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATATCAGTAATCTGTC, downstream forward: _UP4_ATTCGAGAAATGGAGAGAAT
  • BKK22420 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATATCAGTAATCTGTC, downstream forward: _UP4_ATTCGAGAAATGGAGAGAAT