SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


pantothenate synthase
31.81 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast
biosynthesis of coenzyme A
pantothenate synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of coenzyme A]
  • Gene

    2,352,977 2,353,837

    The protein

    Catalyzed reaction/ biological activity

  • (R)-pantoate + ATP + β-alanine --> (R)-pantothenate + AMP + diphosphate + H+ (according to UniProt)
  • Protein family

  • pantothenate synthetase family (single member, according to UniProt)
  • Structure

  • [PDB|2EJC] (from ''Thermotoga maritima'', 50% identity, 66% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials


  • BKE22420 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATATCAGTAATCTGTC, downstream forward: _UP4_ATTCGAGAAATGGAGAGAAT
  • BKK22420 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATATCAGTAATCTGTC, downstream forward: _UP4_ATTCGAGAAATGGAGAGAAT