SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


glutamate-1-semialdehyde aminotransferase, required for [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification
46.04 kDa
protein length
429 aa Sequence Blast
gene length
1290 bp Sequence Blast
biosynthesis of heme, modification of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp]
glutamate-1-semialdehyde aminotransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of heme/ siroheme]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation factor modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • Gene

    942,449 943,738

    Phenotypes of a mutant

  • inactivation suppresses the swarming defect of a [gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI] mutant [pubmed|29615499]
  • The protein

    Catalyzed reaction/ biological activity

  • (S)-4-amino-5-oxopentanoate --> 5-aminolevulinate (according to UniProt)
  • Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A54B2C86638D474F5F892003B42C535B5B39A42E|HemL]
  • Modification

  • pyridoxal phosphate attached to Lys-267 (according to UniProt)
  • [SW|Cofactors]

  • pyridoxal phosphate (attached to Lys-267) (according to UniProt)
  • Structure

  • [PDB|3BS8] ([protein|A54B2C86638D474F5F892003B42C535B5B39A42E|HemL]) [Pubmed|20946885]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE08710 ([gene|8BB8EECA8ECFA1CC6D46E81250905DBC6D2C503E|gsaB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAATAAAAACCTCCTAT, downstream forward: _UP4_TAGAATCAAATACCTTGAAC
  • BKK08710 ([gene|8BB8EECA8ECFA1CC6D46E81250905DBC6D2C503E|gsaB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAATAAAAACCTCCTAT, downstream forward: _UP4_TAGAATCAAATACCTTGAAC
  • References

  • 20946885,29615499