SubtiBank SubtiBank
brnQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

brnQ

branched-chain amino acid transporter
locus
BSU26690
pI
9.78
mw
46.84 kDa
protein length
440 aa Sequence Blast
gene length
1323 bp Sequence Blast
function
uptake of valine and isoleucine
product
branched-chain amino acid transporter
essential
no
synonyms
yrdJ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.12|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,727,160 2,728,482

    Phenotypes of a mutant

  • no phenotype for the single mutant, the triple ''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
  • The protein

    Catalyzed reaction/ biological activity

  • high affinity uptake of isoleucine and valine [Pubmed|25645558]
  • Protein family

  • branched chain amino acid transporter family (together with [protein|75A874F0C344E8404BE39C32EFF59CE562193640|BraB]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|75A874F0C344E8404BE39C32EFF59CE562193640|BraB]
  • Expression and Regulation

    Operons

    genes
    [gene|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|azlB]-[gene|C90D642197EE589F9D33CD5AA0B1069E3BC124A8|azlC]-[gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]-[gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]-[gene|17FFEA4977F4F7334CFF7CD1C644DF14F599E6E6|yrdK]
    description
    [Pubmed|9287000]

    regulatory mechanism

  • [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB]: repression, [Pubmed|9287000], in [regulon|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB regulon]
  • regulation

  • repressed by [protein|search|AzlB] [Pubmed|9287000]
  • view in new tab

    Biological materials

    Mutant

  • BKE26690 ([gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATATCCTCCGATTA, downstream forward: _UP4_ATTCCAGCTATTGCAGGAGG
  • BKK26690 ([gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATATCCTCCGATTA, downstream forward: _UP4_ATTCCAGCTATTGCAGGAGG
  • References

  • 9287000,25645558