SubtiBank SubtiBank
alsR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

alsR

transcriptional activator of the [gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]-[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD] operon
locus
BSU_36020
pI
7.29
mw
34.18 kDa
protein length
302 aa Sequence Blast
gene length
909 bp Sequence Blast
function
regulation of acetoin synthesis ([gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]-[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD])
product
transcriptional activator ([SW|LysR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.5|Overflow metabolism]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,711,498 3,712,406

    Phenotypes of a mutant

  • reduced acetoin production [pubmed|31113899]
  • impaired biofilm development [pubmed|31113899]
  • The protein

    Catalyzed reaction/ biological activity

  • binds the promoter region of the [gene|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|alsS]-[gene|355E70F55A28C6C2C24E8E326EFB673AC303FBEE|alsD] operon in the presence of acetate, activates transcription [pubmed|30039521]
  • Protein family

  • [SW|LysR family] (according to UniProt)
  • [SW|Domains]

  • [SW|HTH lysR-type domain] (aa 1-58) (according to UniProt)
  • Effectors of protein activity

  • acetate (2 molecules per molecule of AlsR) acts as co-factor that triggers activity [pubmed|30039521]
  • Structure

  • [PDB|2H98] (from Acinetobacter baylyi, 34% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]-[gene|EB8E3F88BC1ED2BAD5A98D609EDAA002261150A5|ywrK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • AMBs3 (spc), available in [SW|Jörg Stülke]'s lab
  • 1A978 ( ''alsR''::''cat''), [Pubmed|7685336], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A978&Search=1A978 BGSC]
  • BKE36020 ([gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATATGCATTCCTTT, downstream forward: _UP4_TGAACAATACTTGCAATCTC
  • BKK36020 ([gene|8BA7714236EBFDBB9987F1DACC9775AD974C743E|alsR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATATGCATTCCTTT, downstream forward: _UP4_TGAACAATACTTGCAATCTC
  • labs

  • [SW|Elisabeth Härtig], Braunschweig, Germany [http://www.tu-braunschweig.de/ifm/abt/jahn/groups/bs Homepage]
  • References

    Reviews

  • 23046954
  • Original publications

  • 7685336,21821766,22344650,23576037,22178965,23695583,23836140,30039521,31113899