SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


response regulator aspartate phosphatase, dephosphorylates Spo0F-P, control of the phosphorelay
44.40 kDa
protein length
375 aa Sequence Blast
gene length
1128 bp Sequence Blast
control of sporulation initiation
response regulator aspartate phosphatase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Phosphatases controlling the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Phosphatases controlling the phosphorelay]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,659,213 2,660,340

    The protein

    Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Structure

  • [PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF], 38% identity) [pubmed|23526880]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • repressed by glucose (10-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • BKE25830 ([gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATATTCACCCTTCCCT, downstream forward: _UP4_CAAATATCGAAAGGGGAATG
  • BKK25830 ([gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATATTCACCCTTCCCT, downstream forward: _UP4_CAAATATCGAAAGGGGAATG
  • References

  • 12618455,11466295,10629174,23569278,25225273,23526880