SubtiBank SubtiBank
rapE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rapE

response regulator aspartate phosphatase, dephosphorylates Spo0F-P, control of the phosphorelay
locus
BSU25830
pI
7.31
mw
44.40 kDa
protein length
375 aa Sequence Blast
gene length
1128 bp Sequence Blast
function
control of sporulation initiation
product
response regulator aspartate phosphatase
essential
no
synonyms
yqcH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.5|Phosphatases controlling the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.5|Phosphatases controlling the phosphorelay]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,659,213 2,660,340

    The protein

    Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Structure

  • [PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF], 38% identity) [pubmed|23526880]
  • Expression and Regulation

    Operons

    genes
    [gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]-[gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]
    description
    [Pubmed|11466295,10629174]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • repressed by glucose (10-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE25830 ([gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATATTCACCCTTCCCT, downstream forward: _UP4_CAAATATCGAAAGGGGAATG
  • BKK25830 ([gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATATTCACCCTTCCCT, downstream forward: _UP4_CAAATATCGAAAGGGGAATG
  • References

  • 12618455,11466295,10629174,23569278,25225273,23526880