SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


8-amino-7-oxononanoate synthase
42.42 kDa
protein length
389 aa Sequence Blast
gene length
1170 bp Sequence Blast
biosynthesis of biotin
8-amino-7-oxononanoate synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of biotin]
  • Gene

    3,092,184 3,093,353

    The protein

    Catalyzed reaction/ biological activity

  • pimeloyl-CoA + L-alanine = 8-amino-7-oxononanoate + CoA + CO2 [pubmed|29054876]
  • Protein family

  • [SW|class-II pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|1BC05699DEB3A16944FB8305F22976AED75805E8|Kbl]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|3A2B] (Serine palmitoyltransferase from Sphingobacterium multivorum, 37% identity) [pubmed|19564159]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials


  • BKE30220 ([gene|8B6A3E86A88928526D94FDA94B9C81ABF6E9ACFB|bioF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTAACCGCTCGTTTAACC, downstream forward: _UP4_ATCGGAAAGGAGCTGCACAT
  • BKK30220 ([gene|8B6A3E86A88928526D94FDA94B9C81ABF6E9ACFB|bioF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTAACCGCTCGTTTAACC, downstream forward: _UP4_ATCGGAAAGGAGCTGCACAT
  • References


  • 21437340
  • Original publications

  • 8763940,8892842,21821766,22960854,19564159,29054876