SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, putative bacillredoxin
12.26 kDa
protein length
108 aa Sequence Blast
gene length
327 bp Sequence Blast
putative bacillredoxin

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    3,046,757 3,047,083

    The protein

    Protein family

  • Trx family
  • [SW|Domains]

  • contains a single conserved Cys residue in a motif (TCPIS) reminiscent of that found in monothiol glutaredoxins [Pubmed|20308541]
  • Modification

  • phosphorylation on (Thr-93 OR Ser-94 OR Ser-96 OR Thr-99) [Pubmed|17218307]
  • Structure

  • [PDB|3IV4] (from Staphylococcus aureus, 41% identity)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8733232,11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|8733232], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|8733232,11544224]
  • view in new tab

    Biological materials


  • MGNA-B527 (ytxJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29760 ([gene|8B4E1D087B75B5E77BCB60FF3465270CEB72B028|ytxJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAGCTCTTCCTT, downstream forward: _UP4_TAGAAAAAAGCGTCCAGATA
  • BKK29760 ([gene|8B4E1D087B75B5E77BCB60FF3465270CEB72B028|ytxJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAGCTCTTCCTT, downstream forward: _UP4_TAGAAAAAAGCGTCCAGATA
  • References

  • 11544224,17218307,8733232,20308541