SubtiBank SubtiBank
ytxJ
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

ytxJ

general stress protein, putative bacillredoxin
locus
BSU_29760
pI
5.09
mw
12.26 kDa
protein length
108 aa Sequence Blast
gene length
327 bp Sequence Blast
function
unknown
product
putative bacillredoxin
essential
no
synonyms
csb40

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    3,046,757 3,047,083

    The protein

    Protein family

  • Trx family
  • [SW|Domains]

  • contains a single conserved Cys residue in a motif (TCPIS) reminiscent of that found in monothiol glutaredoxins [Pubmed|20308541]
  • Modification

  • phosphorylation on (Thr-93 OR Ser-94 OR Ser-96 OR Thr-99) [Pubmed|17218307]
  • Structure

  • [PDB|3IV4] (from Staphylococcus aureus, 41% identity)
  • Biological materials

    Mutant

  • MGNA-B527 (ytxJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1526 NBRP B. subtilis, Japan]
  • BKE29760 ([gene|8B4E1D087B75B5E77BCB60FF3465270CEB72B028|ytxJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAGCTCTTCCTT, downstream forward: _UP4_TAGAAAAAAGCGTCCAGATA
  • BKK29760 ([gene|8B4E1D087B75B5E77BCB60FF3465270CEB72B028|ytxJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTCAAGCTCTTCCTT, downstream forward: _UP4_TAGAAAAAAGCGTCCAGATA
  • References

  • 11544224,17218307,8733232,20308541