SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|ABC transporter] (ATP-binding protein)
28.57 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast
export of toxic peptides
[SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Export of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,070,393 4,071,166

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8BF7EB539B53D75BD30BD30ABF27106D6A0B030B|FtsE], [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|BceA], [protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|YknY], [protein|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|YtrE], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO], [protein|464DD1855E6B3195EE242637612A16C73FF32FC0|PsdA]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 5-243) (according to UniProt)
  • Structure

  • [PDB|1L2T] (from Methanocaldococcus jannaschii, 43% identity) [pubmed|12150914]
  • [SW|Localization]

  • plasma membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|YxdJ]: activation, [Pubmed|15289557], in [regulon|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|YxdJ regulon]
  • regulation

  • induced by a cationic antimicrobial peptide, LL-37 ([protein|search|YxdJ]) [Pubmed| 21078927]
  • view in new tab

    Biological materials


  • MGNA-B704 (yxdL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39640 ([gene|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAATCCTCCTTATGG, downstream forward: _UP4_CTGTCTATGCTGGGGGGAAA
  • BKK39640 ([gene|8B4267532B9788AEB5EF39E2695C1FDA494C7055|yxdL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAATCCTCCTTATGG, downstream forward: _UP4_CTGTCTATGCTGGGGGGAAA
  • References

  • 17600057,10092453,15289557,21283517