SubtiBank SubtiBank
splA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

splA

transcriptional repressor of the spore photoproduct lyase splA-splB operon
locus
BSU_13920
pI
4.42
mw
9.08 kDa
protein length
gene length
240 bp Sequence Blast
function
regulation of the splA-splB operon
product
transcriptional regulator
essential
no
synonyms
ykxI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,461,453 1,461,692

    Expression and Regulation

    Operons

    genes
    [gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]-[gene|B873AE29ACAA0714D5F2E8648449B3280353C8AA|splB]
    description
    [Pubmed|8021181]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,8021181], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|SplA]: negative autoregulation, in [regulon|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|SplA regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • BKE13920 ([gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTATCCCTCCTAGCCA, downstream forward: _UP4_TAACAAGGAAATCATTACAA
  • BKK13920 ([gene|8B3B4B181D949BD9B05AD6FCA5B6C773DBD84018|splA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTATCCCTCCTAGCCA, downstream forward: _UP4_TAACAAGGAAATCATTACAA
  • References

    Reviews

  • 23164663
  • Structure of the spore photoproduct lesion in DNA

  • 24598744
  • Original publications

  • 15699190,8021181,22761404,10629212