SubtiBank SubtiBank
ytkL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytkL

general stress protein
locus
BSU_29410
pI
5.01
mw
24.68 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    3,009,915 3,010,598

    The protein

    Protein family

  • UPF0173 family (with [protein|888BC7D4C610DEBA6D46638F5FA1E86C1D433F48|YddR], according to UniProt)
  • Structure

  • [PDB|3X2Z] (from Thermotoga maritima, 49% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|3BF3EC6B3139744D968B2FF18CBEEEF15B591AFF|ytkK]-[gene|8B28AA1A88FA56C9F4742F668B28F3323715D948|ytkL]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A157 (ytkL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/157 NBRP B. subtilis, Japan]
  • BKE29410 ([gene|8B28AA1A88FA56C9F4742F668B28F3323715D948|ytkL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTCACCTCGTCAC, downstream forward: _UP4_TAAACCGTGAAACCATCTCC
  • BKK29410 ([gene|8B28AA1A88FA56C9F4742F668B28F3323715D948|ytkL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTCACCTCGTCAC, downstream forward: _UP4_TAAACCGTGAAACCATCTCC
  • References

  • 15805528,9387221