SubtiBank SubtiBank
brxB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

brxB

bacilliredoxin
locus
BSU23990
pI
4.81
mw
16.05 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
function
de-bacillithiolation of S-bacillithiolated [protein|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR] and [protein|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|MetE]
product
bacilliredoxin
essential
no
synonyms
yqiW

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,493,064 2,493,501

    The protein

    Catalyzed reaction/ biological activity

  • de-bacillithiolation of S-bacillithiolated [protein|7A3A8AF7728474204396BB7A548F747D28E6FAC7|OhrR] and [protein|23F405D5B849E4EDC1D599F86C71DFD2E55C0305|MetE] [Pubmed|24313874]
  • Protein family

  • UPF0403 family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|BrxA]
  • [SW|Domains]

  • contains an CxC redox motif redox active Cys residue [Pubmed|20308541]
  • Structure

  • [PDB|3FHK] ([protein|FBE3C55526FE0CBBDA71AE0B0D7C6AD074E8A63E|BrxA]) [Pubmed|19653655]
  • Expression and Regulation

    Operons

    genes
    [gene|8B134BDC82C92DB7747A3AF291C96BB0F223D0CF|brxB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C380 (yqiW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2378 NBRP B. subtilis, Japan]
  • BKE23990 ([gene|8B134BDC82C92DB7747A3AF291C96BB0F223D0CF|brxB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAGACCTCTCCTTTT, downstream forward: _UP4_TAAGACGAACAACCCGGATG
  • BKK23990 ([gene|8B134BDC82C92DB7747A3AF291C96BB0F223D0CF|brxB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAGACCTCTCCTTTT, downstream forward: _UP4_TAAGACGAACAACCCGGATG
  • References

  • 24313874,20308541,19653655