SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


D-chiro-inositol transport protein
52.59 kDa
protein length
482 aa Sequence Blast
gene length
1449 bp Sequence Blast
uptake of D-chiro-inositol
D-chiro-inositol transport protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of inositol]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    900,080 901,528

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|YncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|AraE], [protein|7CE5A42042E5D52768735E795DB805530691D8A6|YwtG]
  • Structure

  • [PDB|4LDS] (from Staphylococcus epidermidis, 37% identity) [pubmed|24127585]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C297 (yfiG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08260 ([gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGCTTTCTTCCCCTTCT, downstream forward: _UP4_TAACCTGAGATACCAGGAGG
  • BKK08260 ([gene|8B0701B5694ABA8142476CB896E590FE1981D7DB|yfiG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGCTTTCTTCCCCTTCT, downstream forward: _UP4_TAACCTGAGATACCAGGAGG
  • References

    Research papers

  • 24127585