SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


18.48 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,082,531 2,083,013

    Biological materials


  • MGNA-A317 (yobU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19090 ([gene|8AD776B008EA63C1E50D196BE63894C122B4AA41|yobU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGATCTCCTCCTTTTT, downstream forward: _UP4_TAATAAACTCTTGAAAAACT
  • BKK19090 ([gene|8AD776B008EA63C1E50D196BE63894C122B4AA41|yobU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGATCTCCTCCTTTTT, downstream forward: _UP4_TAATAAACTCTTGAAAAACT