SubtiBank SubtiBank
yobU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yobU

unknown
locus
BSU_19090
pI
4.76
mw
18.48 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,082,531 2,083,013

    Biological materials

    Mutant

  • MGNA-A317 (yobU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/317 NBRP B. subtilis, Japan]
  • BKE19090 ([gene|8AD776B008EA63C1E50D196BE63894C122B4AA41|yobU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGATCTCCTCCTTTTT, downstream forward: _UP4_TAATAAACTCTTGAAAAACT
  • BKK19090 ([gene|8AD776B008EA63C1E50D196BE63894C122B4AA41|yobU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGATCTCCTCCTTTTT, downstream forward: _UP4_TAATAAACTCTTGAAAAACT