The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
phosphoglycerate dehydrogenase
function
biosynthesis of serine
product
phosphoglycerate dehydrogenase
Genomic Context
categories
[category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.8|Biosynthesis/ acquisition of serine/ glycine/ alanine][category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]Gene
Coordinates
2,411,086 2,412,663
The protein
Catalyzed reaction/ biological activity
3-phospho-D-glycerate + NAD+ --> 3-phosphooxypyruvate + H+ + NADH (according to UniProt)(R)-2-hydroxyglutarate + NAD+ --> 2-oxoglutarate + H+ + NADH (according to UniProt)Protein family
D-isomer specific 2-hydroxyacid dehydrogenase family (with [protein|B0145F4E13F004ECC773E8758B5844669F4C74D7|YvcT] and [protein|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|YoaD], according to UniProt)[SW|Domains]
[SW|ACT domain] (aa 452 ... 524) (according to the Interpro database)Modification
S-cysteinylation after diamide stress (C410)[Pubmed|17611193]active site Cys410 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]Structure
[PDB|1YBA] (from ''E. coli'', 30% identity, 52% similarity) [Pubmed|15823035][SW|Localization]
membrane [Pubmed|18763711]additional information
belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]Expression and Regulation
Operons
genes
[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]
description
[Pubmed|7934830]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [pubmed|31138626], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]regulation
activated by [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] [Pubmed|31138626]expression decreases during entry into the stationary phase [pubmed|31138626]view in new tabBiological materials
Mutant
GP2392 ∆''[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]''::''zeo'', available in [SW|Jörg Stülke]'s lab1A614 (''serA''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A614&Search=1A614 BGSC] and in [SW|Jörg Stülke]'s labBKE23070 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCTBKK23070 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCTlacZ fusion
pGP187 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s labpGP2287 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s labReferences
22938038,17611193,7934830,18763711,15823035,21749987,15378759,31138626