SubtiBank SubtiBank
serA [2019-02-06 09:41:45]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

serA [2019-02-06 09:41:45]

phosphoglycerate dehydrogenase
56.95 kDa
protein length
525 aa Sequence Blast
gene length
1578 bp Sequence Blast
biosynthesis of serine
phosphoglycerate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,411,086 2,412,663

    The protein

    Catalyzed reaction/ biological activity

  • 3-phospho-D-glycerate + NAD+ = 3-phosphonooxypyruvate + NADH (according to Swiss-Prot)
  • Protein family

  • D-isomer specific 2-hydroxyacid dehydrogenase family (according to Swiss-Prot)
  • [SW|Domains]

  • [SW|ACT domain] (aa 452 ... 524) (according to the Interpro database)
  • Modification

  • S-cysteinylation after diamide stress (C410)[Pubmed|17611193]
  • active site Cys410 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
  • Structure

  • [PDB|1YBA] (from ''E. coli'', 30% identity, 52% similarity) [Pubmed|15823035]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [pubmed|31138626], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • activated by [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] [Pubmed|31138626]
  • expression decreases during entry into the stationary phase [pubmed|31138626]
  • view in new tab

    Biological materials


  • GP2392 ∆''[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]''::''zeo'', available in [SW|Jörg Stülke]'s lab
  • 1A614 (''serA''::''erm''), [Pubmed|3015878], available at [ BGSC] and in [SW|Jörg Stülke]'s lab
  • BKE23070 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCT
  • BKK23070 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCT
  • lacZ fusion

  • pGP187 (in [protein|search|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

  • 22938038,17611193,7934830,18763711,15823035,21749987,23033921,15378759