SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


phosphoglycerate dehydrogenase
56.95 kDa
protein length
525 aa Sequence Blast
gene length
1578 bp Sequence Blast
biosynthesis of serine
phosphoglycerate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,411,086 2,412,663

    Phenotypes of a mutant

  • auxotrophic for serine [pubmed|32743959]
  • The protein

    Catalyzed reaction/ biological activity

  • 3-phospho-D-glycerate + NAD+ --> 3-phosphooxypyruvate + H+ + NADH (according to UniProt)
  • (R)-2-hydroxyglutarate + NAD+ --> 2-oxoglutarate + H+ + NADH (according to UniProt)
  • Protein family

  • D-isomer specific 2-hydroxyacid dehydrogenase family (with [protein|B0145F4E13F004ECC773E8758B5844669F4C74D7|YvcT] and [protein|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|YoaD], according to UniProt)
  • [SW|Domains]

  • [SW|ACT domain] (aa 452-524) (according to UniProt)
  • Modification

  • S-cysteinylation after diamide stress (C410)[Pubmed|17611193]
  • active site Cys410 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|21749987] [Pubmed|22938038]
  • Structure

  • [PDB|1YBA] (from ''E. coli'', 30% identity, 52% similarity) [Pubmed|15823035]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [pubmed|31138626], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • activated by [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] [Pubmed|31138626]
  • expression decreases during entry into the stationary phase [pubmed|31138626]
  • view in new tab

    Biological materials


  • GP2392 ∆''[gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]''::''zeo'', available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • 1A614 (''serA''::''erm''), [Pubmed|3015878], available at [ BGSC] and in [SW|Jörg Stülke]'s lab
  • BKE23070 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCT
  • BKK23070 ([gene|8AD1C7C761FF8B407A973381CA135C264B995CB7|serA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTAGATTTCCTCCTA, downstream forward: _UP4_TAATTAAAAAAACTCAAGCT
  • lacZ fusion

  • pGP187 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • pGP2287 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

  • 22938038,17611193,7934830,18763711,15823035,21749987,15378759,31138626,32743959