SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


modulator of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]-containing [SW|RNA polymerase]
16.63 kDa
protein length
124 aa Sequence Blast
gene length
375 bp Sequence Blast
control of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]-dependent [SW|transcription]
modulator of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]-containing [SW|RNA polymerase]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,616,267 1,616,641

    Phenotypes of a mutant

  • defective in spore [SW|germination] efficiency [Pubmed|23123912]
  • The protein

    Paralogous protein(s)

  • [protein|633F6F54AFA144D4F65EA36B8D5670D3FC25EDA6|YocK], [protein|70A5A147B908001878161D45AAEB08132AD0DB8C|YteA]
  • [SW|Localization]

  • located at the cell periphery [Pubmed|18720851]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|23123912], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|23123912], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during [SW|sporulation] in the forespore ([protein|search|SigG], [SW|SpoVT]) [Pubmed|23123912]
  • view in new tab

    Biological materials


  • MGNA-B126 (ylyA::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A816 ( ''ylyA''::''erm''), [Pubmed|12682299], available at [ BGSC]
  • BKE15440 ([gene|8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5|ylyA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTCACAACTCCTGCT, downstream forward: _UP4_TAACAGTGTCTGTCCGGTTA
  • BKK15440 ([gene|8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5|ylyA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTCACAACTCCTGCT, downstream forward: _UP4_TAACAGTGTCTGTCCGGTTA
  • References

  • 23123912,18720851,22383849,23678950