SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to rRNA methylase
26.75 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|rRNA modification and maturation]
  • Gene

    2,930,827 2,931,573

    Phenotypes of a mutant

  • essential [Pubmed|17114254], non-essential according to [Pubmed|28189581]
  • The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|YacO]
  • [SW|Cofactors]

  • SAM (according to UniProt)
  • Structure

  • [PDB|4X3M]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B006 (ysgA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28650 ([gene|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|ysgA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTCTATGTGGCGCTCC, downstream forward: _UP4_TAGTGTTGCGCCAAGCGTTG
  • BKK28650 ([gene|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|ysgA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTCTATGTGGCGCTCC, downstream forward: _UP4_TAGTGTTGCGCCAAGCGTTG
  • References

  • 17114254,8969504,28189581