SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


similar to rRNA methylase
26.75 kDa
protein length
248 aa Sequence Blast
gene length
744 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|rRNA modification and maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    2,930,827 → 2,931,573

    Phenotypes of a mutant

  • essential [Pubmed|17114254], non-essential according to [Pubmed|28189581]
  • The protein

    Protein family

  • RNA methyltransferase trmH family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|YacO]
  • Structure

  • [PDB|4X3M]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B006 (ysgA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28650 (Δ[gene|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|ysgA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTCTATGTGGCGCTCC, downstream forward: _UP4_TAGTGTTGCGCCAAGCGTTG
  • BKK28650 (Δ[gene|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|ysgA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTCTATGTGGCGCTCC, downstream forward: _UP4_TAGTGTTGCGCCAAGCGTTG
  • References

  • 17114254,8969504,28189581