SubtiBank SubtiBank
ysgA
The papers of the month are back! Check them out! Link here

ysgA

similar to rRNA methylase
locus
BSU28650
pI
5.18
mw
26.75 kDa
protein length
248 aa Sequence Blast
gene length
744 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
2.1.1.-
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • Gene

    Coordinates
    2,930,827 → 2,931,573

    Phenotypes of a mutant

  • essential [Pubmed|17114254], non-essential according to [Pubmed|28189581]
  • The protein

    Protein family

  • RNA methyltransferase trmH family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|YacO]
  • [SW|Cofactors]

  • SAM (according to UniProt)
  • Structure

  • [PDB|4X3M]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|ysgA]
    description
    [Pubmed|8969504]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B006 (ysgA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1005 NBRP B. subtilis, Japan]
  • BKE28650 (Δ[gene|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|ysgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTCTATGTGGCGCTCC, downstream forward: _UP4_TAGTGTTGCGCCAAGCGTTG
  • BKK28650 (Δ[gene|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|ysgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTCTATGTGGCGCTCC, downstream forward: _UP4_TAGTGTTGCGCCAAGCGTTG
  • References

  • 17114254,8969504,28189581