SubtiBank SubtiBank
yizC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yizC

unknown
locus
BSU_11139
pI
5.12
mw
7.40 kDa
protein length
gene length
198 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,190,036 1,190,233

    Expression and Regulation

    Operons

    genes
    [gene|29EFA7585D7B2FD3A2CDBE2F21AB6742980759B4|yitU]-[gene|8A1EEBB7F3CA4ADE6C1D9ADACFC00DCEF29C3304|yizC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [pubmed|30782632], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • view in new tab

    genes
    [gene|8A1EEBB7F3CA4ADE6C1D9ADACFC00DCEF29C3304|yizC]
    description
    [pubmed|22383849]
    view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • BKE11139 ([gene|8A1EEBB7F3CA4ADE6C1D9ADACFC00DCEF29C3304|yizC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11139 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAATATTCATACTGCC, downstream forward: _UP4_TAAAAAAAGGCTATGGCGAC
  • BKK11139 ([gene|8A1EEBB7F3CA4ADE6C1D9ADACFC00DCEF29C3304|yizC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11139 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAATATTCATACTGCC, downstream forward: _UP4_TAAAAAAAGGCTATGGCGAC
  • References

    Research papers

  • 30782632