SubtiBank SubtiBank
xynD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

xynD

arabinoxylan arabinofuranohydrolase
locus
BSU_18160
pI
8.03
mw
54.33 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast
function
arabinoxylan degradation
product
arabinoxylan arabinofuranohydrolase
essential
no
ec
3.2.1.55
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,944,113 1,945,654

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal non-reducing alpha-L-arabinofuranoside residues in alpha-L-arabinosides (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 43 family] (according to UniProt)
  • [SW|Domains]

  • CBM6 domain (aa 382-511) (accordig to UniProt)
  • Structure

  • [PDB|3C7O] [Pubmed|18980579]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|8A02D56A403BF2E34B84DF0F44347AA2D091D831|xynD]-[gene|55D7F05F8592A53A58A032C78B847782E598B268|xynC]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE18160 ([gene|8A02D56A403BF2E34B84DF0F44347AA2D091D831|xynD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTTCACATCCTCCTT, downstream forward: _UP4_TAGTACTCGTAATGGGACCG
  • BKK18160 ([gene|8A02D56A403BF2E34B84DF0F44347AA2D091D831|xynD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTTCACATCCTCCTT, downstream forward: _UP4_TAGTACTCGTAATGGGACCG
  • References

  • 18957862,20817675,18980579