SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


arabinoxylan arabinofuranohydrolase
54.33 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast
arabinoxylan degradation
arabinoxylan arabinofuranohydrolase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,944,113 1,945,654

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal non-reducing alpha-L-arabinofuranoside residues in alpha-L-arabinosides (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 43 family] (according to UniProt)
  • [SW|Domains]

  • CBM6 domain (aa 382-511) (accordig to UniProt)
  • Structure

  • [PDB|3C7O] [Pubmed|18980579]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • BKE18160 ([gene|8A02D56A403BF2E34B84DF0F44347AA2D091D831|xynD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTTCACATCCTCCTT, downstream forward: _UP4_TAGTACTCGTAATGGGACCG
  • BKK18160 ([gene|8A02D56A403BF2E34B84DF0F44347AA2D091D831|xynD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTTCACATCCTCCTT, downstream forward: _UP4_TAGTACTCGTAATGGGACCG
  • References

  • 18957862,20817675,18980579