SubtiBank SubtiBank
yqgP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqgP

intramembrane protease
locus
BSU_24870
pI
5.51
mw
56.27 kDa
protein length
507 aa Sequence Blast
gene length
1524 bp Sequence Blast
function
cell division or sugar metabolism
product
intramembrane protease
essential
no
synonyms
glpG,gluP

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,571,907 2,573,430

    Phenotypes of a mutant

  • filamentous phenotype [Pubmed|15050034]
  • The protein

    Catalyzed reaction/ biological activity

  • Cleaves type-1 transmembrane domains using a catalytic dyad composed of serine and histidine that are contributed by different transmembrane domains (according to UniProt)
  • Protein family

  • [SW|peptidase S54 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D941248711FEB7F3698AF7B02EED95722605CF72|YdcA]: [SW|peptidase S54 family]
  • [SW|Domains]

  • two [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|22921757]
  • Expression and Regulation

    Operons

    genes
    [gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]-[gene|C44F6723A2F1A627A0B9042871A07F5365D6121A|yqgO]-[gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]-[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]
    description
    [pubmed|22383849]

    additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C445 (yqgP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2443 NBRP B. subtilis, Japan]
  • BKE24870 ([gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACCGCTCCAATAG, downstream forward: _UP4_TAGAGGTGGAATATGGAAAG
  • BKK24870 ([gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACCGCTCCAATAG, downstream forward: _UP4_TAGAGGTGGAATATGGAAAG
  • References

    Reviews

  • 23518036
  • Original publications

  • 19421188,15050034,22921757