SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


16.46 kDa
protein length
146 aa Sequence Blast
gene length
441 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    524,782 525,222

    The protein

    Protein family

  • UPF0310 family (single member, according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|B7F5FA5C656D39970959BC857E93B78B1A063098|PamR]: repression, [pubmed|29240826], in [regulon|B7F5FA5C656D39970959BC857E93B78B1A063098|PamR regulon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-C095 (ydcG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04760 ([gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGCCGATCCAGTAATTTG, downstream forward: _UP4_GCACAAGCGATGGGAGTTAA
  • BKK04760 ([gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGCCGATCCAGTAATTTG, downstream forward: _UP4_GCACAAGCGATGGGAGTTAA
  • References

    Research papers

  • 29240826