SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


56.37 kDa
protein length
487 aa Sequence Blast
gene length
1464 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    820,867 822,330

    The protein


  • phosphorylated on Arg-474 [Pubmed|22517742]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (4-fold) [Pubmed|12850135]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yfmI]' and '[protein|search|yfmG]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-C243 (yfmG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07480 ([gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTACGATAACCTCCCG, downstream forward: _UP4_TAATCATTCTAGGTTAGAGA
  • BKK07480 ([gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTACGATAACCTCCCG, downstream forward: _UP4_TAATCATTCTAGGTTAGAGA
  • References

  • 22517742,20817675,21815947,12850135,20525796