SubtiBank SubtiBank
yfmG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfmG

unknown
locus
BSU_07480
pI
5.18
mw
56.37 kDa
protein length
487 aa Sequence Blast
gene length
1464 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    820,867 822,330

    The protein

    Modification

  • phosphorylated on Arg-474 [Pubmed|22517742]
  • Expression and Regulation

    Operons

    genes
    [gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (4-fold) [Pubmed|12850135]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yfmI]' and '[protein|search|yfmG]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C243 (yfmG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2241 NBRP B. subtilis, Japan]
  • BKE07480 ([gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTACGATAACCTCCCG, downstream forward: _UP4_TAATCATTCTAGGTTAGAGA
  • BKK07480 ([gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTACGATAACCTCCCG, downstream forward: _UP4_TAATCATTCTAGGTTAGAGA
  • References

  • 22517742,20817675,21815947,12850135,20525796