SubtiBank SubtiBank
yfmG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfmG

unknown
locus
BSU07480
pI
5.18
mw
56.37 kDa
protein length
487 aa Sequence Blast
gene length
1464 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    820,867 822,330

    The protein

    Modification

  • phosphorylated on Arg-474 [Pubmed|22517742]
  • Expression and Regulation

    Operons

    genes
    [gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (4-fold) [Pubmed|12850135]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yfmI]' and '[protein|search|yfmG]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C243 (yfmG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2241 NBRP B. subtilis, Japan]
  • BKE07480 ([gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTACGATAACCTCCCG, downstream forward: _UP4_TAATCATTCTAGGTTAGAGA
  • BKK07480 ([gene|893BB8D1B43F10B46BB7F2DBFE9BE63E9AEEE8EB|yfmG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATTACGATAACCTCCCG, downstream forward: _UP4_TAATCATTCTAGGTTAGAGA
  • References

  • 22517742,20817675,21815947,12850135,20525796