SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


phosphinothricin acetyltransferase
18.22 kDa
protein length
163 aa Sequence Blast
gene length
492 bp Sequence Blast
phosphinothricin acetyltransferase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    3,760,694 3,761,185

    The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + phosphinothricin --> CoA + H+ + N-acetylphosphinothricin (according to UniProt)
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 1-158) (according to UniProt)
  • Structure

  • [PDB|1VHS] [pubmed|16021622]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A206 (ywnH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36560 ([gene|891DBC0CAB749A3ED4103CD603C61DED34B058B1|ywnH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATACGTTTTTGGC, downstream forward: _UP4_TCATGATTAGTCTGGATAAA
  • BKK36560 ([gene|891DBC0CAB749A3ED4103CD603C61DED34B058B1|ywnH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATACGTTTTTGGC, downstream forward: _UP4_TCATGATTAGTCTGGATAAA
  • References

  • 27694229,16021622