SubtiBank SubtiBank
ywnH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywnH

phosphinothricin acetyltransferase
locus
BSU_36560
pI
5.28
mw
18.22 kDa
protein length
163 aa Sequence Blast
gene length
492 bp Sequence Blast
function
unknown
product
phosphinothricin acetyltransferase
essential
no
ec
2.3.1.183
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    Coordinates
    3,760,694 3,761,185

    The protein

    Catalyzed reaction/ biological activity

  • acetyl-CoA + phosphinothricin --> CoA + H+ + N-acetylphosphinothricin (according to UniProt)
  • Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 1-158) (according to UniProt)
  • Structure

  • [PDB|1VHS] [pubmed|16021622]
  • Expression and Regulation

    Operons

    genes
    [gene|891DBC0CAB749A3ED4103CD603C61DED34B058B1|ywnH]-[gene|D09E0307CD931FBAE32B6FF5E19D71A612F0F790|ywnG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A206 (ywnH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/206 NBRP B. subtilis, Japan]
  • BKE36560 ([gene|891DBC0CAB749A3ED4103CD603C61DED34B058B1|ywnH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATACGTTTTTGGC, downstream forward: _UP4_TCATGATTAGTCTGGATAAA
  • BKK36560 ([gene|891DBC0CAB749A3ED4103CD603C61DED34B058B1|ywnH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATACGTTTTTGGC, downstream forward: _UP4_TCATGATTAGTCTGGATAAA
  • References

  • 27694229,16021622