SubtiBank SubtiBank
hisB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hisB

imidazoleglycerol-phosphate dehydratase
locus
BSU34900
pI
5.60
mw
21.40 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
function
biosynthesis of histidine
product
imidazoleglycerol-phosphate dehydratase
essential
no
ec
4.2.1.19
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.14|Biosynthesis/ acquisition of histidine]
  • Gene

    Coordinates
    3,585,690 3,586,274

    The protein

    Catalyzed reaction/ biological activity

  • D-erythro-1-(imidazol-4-yl)glycerol 3-phosphate = 3-(imidazol-4-yl)-2-oxopropyl phosphate + H2O (according to Swiss-Prot)
  • Protein family

  • imidazoleglycerol-phosphate dehydratase family (according to Swiss-Prot)
  • Structure

  • [PDB|2AE8] (from ''Staphylococcus aureus subsp. aureus n315 mutant'', 48% identity, 65% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|E8FD92F48BE16F87D7481262F4E49003A78DE78F|hisZ]-[gene|183C8B4F28E601D670B3D997D333AF2B5C4A4759|hisG]-[gene|03274B80B2DFE0A2939981B0E0CB8C34A9B0B102|hisD]-[gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]-[gene|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH]-[gene|148F0C7983250F50676D234DB713E532AA55DDBF|hisA]-[gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]-[gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE34900 ([gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCCTGACGCGTTCCGCTT, downstream forward: _UP4_CCGTCAACGAAAGGGATGCT
  • BKK34900 ([gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCCTGACGCGTTCCGCTT, downstream forward: _UP4_CCGTCAACGAAAGGGATGCT
  • References

  • 12107147,15378759,27766092