SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


N-acetylmuramic acid deacetylase, spore cortex peptidoglycan synthesis
29.92 kDa
protein length
263 aa Sequence Blast
gene length
792 bp Sequence Blast
spore cortex peptidoglycan synthesis
N-acetylmuramic acid deacetylase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    869,559 870,350

    The protein

    Catalyzed reaction/ biological activity

  • de-N-acetylation of N-acetylglucosamine and N-acetyl-muramic acid for spore cortex peptidoglycan [Pubmed|15687192]
  • Protein family

  • [SW|polysaccharide deacetylase family] (according to UniProt)
  • Structure

  • [PDB|1W17] [pubmed|15251431]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|12374835,15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|12374835,15699190]
  • view in new tab

    Biological materials


  • MGNA-C273 (yfjS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07980 ([gene|88E167795BBCB8529E322E3A4DC9965EA6AAA617|pdaA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCCAGCGCTCCTTCTG, downstream forward: _UP4_TAAAAGAGAAAGACCTCTCC
  • BKK07980 ([gene|88E167795BBCB8529E322E3A4DC9965EA6AAA617|pdaA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCCAGCGCTCCTTCTG, downstream forward: _UP4_TAAAAGAGAAAGACCTCTCC
  • References

  • 12374835,15687192,15699190,15251431,14679227,24405365