SubtiBank SubtiBank
bmrU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bmrU

general stress protein, multidrug resistance protein, similar to diacylglycerol kinase
locus
BSU_24000
pI
5.39
mw
32.31 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
multidrug resistance
product
multidrug resistance protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    Coordinates
    2,493,662 2,494,555

    The protein

    Protein family

  • diacylglycerol/lipid kinase family (with [protein|943294ACA74067A8549056699E08DF5B82337976|DgkB] and [protein|ED4C1EA16FF96DA20F12B972CD2458FA3B49DDA5|YtlR], according to UniProt)
  • Paralogous protein(s)

  • [protein|943294ACA74067A8549056699E08DF5B82337976|DgkB]
  • [SW|Domains]

  • DAGKc domain (1-132) (according to UniProt)
  • Structure

  • [PDB|3S40] (from ''B. anthracis'', 39% identity, 73% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|bmrU]-[gene|ADBC0F194B601F736492E54011E0A68351B5BD39|bmr]-[gene|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|bmrR]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|bmrU]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE24000 ([gene|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|bmrU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACAACTGCTCCTTTA, downstream forward: _UP4_TAACTGTCATAAGGCTTTAG
  • BKK24000 ([gene|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|bmrU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACAACTGCTCCTTTA, downstream forward: _UP4_TAACTGTCATAAGGCTTTAG
  • References

  • 10220166,11544224