SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, multidrug resistance protein, similar to diacylglycerol kinase
32.31 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
multidrug resistance
multidrug resistance protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    2,493,662 2,494,555

    The protein

    Protein family

  • diacylglycerol/lipid kinase family (with [protein|943294ACA74067A8549056699E08DF5B82337976|DgkB] and [protein|ED4C1EA16FF96DA20F12B972CD2458FA3B49DDA5|YtlR], according to UniProt)
  • Paralogous protein(s)

  • [protein|943294ACA74067A8549056699E08DF5B82337976|DgkB]
  • [SW|Domains]

  • DAGKc domain (1-132) (according to UniProt)
  • Structure

  • [PDB|3S40] (from ''B. anthracis'', 39% identity, 73% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|bmrU]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE24000 ([gene|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|bmrU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACAACTGCTCCTTTA, downstream forward: _UP4_TAACTGTCATAAGGCTTTAG
  • BKK24000 ([gene|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|bmrU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACAACTGCTCCTTTA, downstream forward: _UP4_TAACTGTCATAAGGCTTTAG
  • References

  • 10220166,11544224