SubtiBank SubtiBank
yddR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yddR

similar to isothiocyanate hydrolase
locus
BSU_05080
pI
5.12
mw
28.35 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    553,711 554,475

    The protein

    Protein family

  • UPF0173 family (with [protein|8B28AA1A88FA56C9F4742F668B28F3323715D948|YtkL], according to UniProt)
  • Structure

  • [PDB|6BRM] (46% identity)
  • Biological materials

    Mutant

  • MGNA-C126 (yddR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2124 NBRP B. subtilis, Japan]
  • BKE05080 ([gene|888BC7D4C610DEBA6D46638F5FA1E86C1D433F48|yddR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACAACTCACTTTC, downstream forward: _UP4_TAATATGAACACCGACAAAT
  • BKK05080 ([gene|888BC7D4C610DEBA6D46638F5FA1E86C1D433F48|yddR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACAACTCACTTTC, downstream forward: _UP4_TAATATGAACACCGACAAAT
  • References

  • 20525796