SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to isothiocyanate hydrolase
28.35 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    553,711 554,475

    The protein

    Protein family

  • UPF0173 family (with [protein|8B28AA1A88FA56C9F4742F668B28F3323715D948|YtkL], according to UniProt)
  • Structure

  • [PDB|6BRM] (46% identity)
  • Biological materials


  • MGNA-C126 (yddR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05080 ([gene|888BC7D4C610DEBA6D46638F5FA1E86C1D433F48|yddR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACAACTCACTTTC, downstream forward: _UP4_TAATATGAACACCGACAAAT
  • BKK05080 ([gene|888BC7D4C610DEBA6D46638F5FA1E86C1D433F48|yddR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTACAACTCACTTTC, downstream forward: _UP4_TAATATGAACACCGACAAAT
  • References

  • 20525796