SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


modulation of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] activity in response to attractants, scaffold protein
17.36 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
control of [protein|6B3B222E56BF0C95A2371CA5208B5522B44D4689|CheA] activity
CheA modulator

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Coupling proteins]
  • Gene

    1,714,855 1,715,325

    Phenotypes of a mutant

  • ''[gene|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|cheV] [gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]'' double mutants exhibit complete loss of chemotaxis [Pubmed|21098025]
  • The protein

    Paralogous protein(s)

  • [protein|56E391BD4C154A603FFD06CEC7BC5615AAC5AD04|CheV]:
  • [SW|Domains]

  • CheW-like domain (aa 8-148) (according to UniProt)
  • Structure

  • [PDB|2HO9] (from E. coli, 28% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • predominantly present at the cell poles [Pubmed|21098025]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE16440 ([gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAGACACCTCCTCGA, downstream forward: _UP4_GCTTAATCTTAAAGGGGTTA
  • BKK16440 ([gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAGACACCTCCTCGA, downstream forward: _UP4_GCTTAATCTTAAAGGGGTTA
  • References


  • 20122866
  • Original publications

  • 8169224,1601874,14731274,1624415,14651647,9657996,8157612,15175317,17850253,21098025,21515776,24386445,25039821