SubtiBank SubtiBank
ytpQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytpQ

unknown
locus
BSU29830
pI
5.30
mw
30.89 kDa
protein length
269 aa Sequence Blast
gene length
810 bp Sequence Blast
function
maybe involved in iron homeostasis
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,053,364 3,054,173

    Phenotypes of a mutant

  • derepression of the [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur] and [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR] regulons [Pubmed|21949854]
  • elevated oxidative protein damage upon exposure of the cells to methylglyoxal [Pubmed|21949854]
  • the ''[gene|2C6386E9A63F410558D168798D077DF91590F454|spx] [gene|886EF2F8A9E031FDF919E01A858C1DBC1AFF1188|ytpQ]'' doulbe mutant shows reduced growth in minimal medium and hypersensitivity to methylglyoxal [Pubmed|21949854]
  • The protein

    Protein family

  • UPF0354 family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|314D5C01B4BDDC3B122F6D4066647B143B2A6543|ytpP]-[gene|886EF2F8A9E031FDF919E01A858C1DBC1AFF1188|ytpQ]-[gene|EE559CD606562097F09DC627F431CA31129D7BC6|ytpR]
    description
    [Pubmed|21949854]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21949854], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|21949854], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A437 (ytpQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/437 NBRP B. subtilis, Japan]
  • BKE29830 ([gene|886EF2F8A9E031FDF919E01A858C1DBC1AFF1188|ytpQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCAAACCGATGTCCT, downstream forward: _UP4_AAGGATTAGAAAGGATTTTT
  • BKK29830 ([gene|886EF2F8A9E031FDF919E01A858C1DBC1AFF1188|ytpQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCAAACCGATGTCCT, downstream forward: _UP4_AAGGATTAGAAAGGATTTTT
  • References

  • 21949854