SubtiBank SubtiBank
cypC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cypC

long chain-fatty acid beta-hydroxylating cytochrome P450, H(2)O(2)-dependent, hydroxylates myristic acid to beta-hydroxymyristic acid, required for protection against paraquat stress
locus
BSU_02100
pI
6.47
mw
47.95 kDa
protein length
417 aa Sequence Blast
gene length
1254 bp Sequence Blast
function
biosynthesis of beta-hydroxy fatty acid for lipopeptides
product
fatty acid beta-hydroxylating cytochrome P450, protection against paraquat stress
essential
no
synonyms
ybdT

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    229,525 230,778

    The protein

    Catalyzed reaction/ biological activity

  • hydroxylation of a long-chain fatty acid (e.g. myristic acid) at the alpha- and beta-positions using hydrogen peroxide as an oxidant [Pubmed|12519760]
  • 1,2-saturated fatty acid + H2O2 --> 2-hydroxy fatty acid + H2O (according to UniProt)
  • 2,3-saturated fatty acid + H2O2 --> 3-hydroxy fatty acid + H2O (according to UniProt)
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Structure

  • [PDB|2ZQJ] [PDB|1IZO][Pubmed|12519760]
  • Expression and Regulation

    Operons

    genes
    [gene|88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205|cypC]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/cypC.html DBTBS]) null

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B961 (ybdT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1960 NBRP B. subtilis, Japan]
  • BKE02100 ([gene|88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205|cypC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGCTTACCCTGCCTTC, downstream forward: _UP4_TAAATTAAAAAGCTCTCTTC
  • BKK02100 ([gene|88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205|cypC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGCTTACCCTGCCTTC, downstream forward: _UP4_TAAATTAAAAAGCTCTCTTC
  • References

  • 12297285,11827534,11566026,17385817,11914497,10529095,12519760,15805528,23586998,20697922,21673922,22582280