SubtiBank SubtiBank
cypC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cypC

long chain-fatty acid beta-hydroxylating cytochrome P450, H(2)O(2)-dependent, hydroxylates myristic acid to beta-hydroxymyristic acid, required for protection against paraquat stress
locus
BSU02100
pI
6.47
mw
47.95 kDa
protein length
417 aa Sequence Blast
gene length
1254 bp Sequence Blast
function
biosynthesis of beta-hydroxy fatty acid for lipopeptides
product
fatty acid beta-hydroxylating cytochrome P450, protection against paraquat stress
essential
no
synonyms
ybdT

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    229,525 230,778

    The protein

    Catalyzed reaction/ biological activity

  • hydroxylation of a long-chain fatty acid (e.g. myristic acid) at the alpha- and beta-positions using hydrogen peroxide as an oxidant [Pubmed|12519760]
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Structure

  • [PDB|2ZQJ] [PDB|1IZO][Pubmed|12519760]
  • Expression and Regulation

    Operons

    genes
    [gene|88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205|cypC]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/cypC.html DBTBS]) null

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B961 (ybdT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1960 NBRP B. subtilis, Japan]
  • BKE02100 ([gene|88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205|cypC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGCTTACCCTGCCTTC, downstream forward: _UP4_TAAATTAAAAAGCTCTCTTC
  • BKK02100 ([gene|88653A48CD7DD9C52CC6FA55FF69F6FDDBE2E205|cypC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGCTTACCCTGCCTTC, downstream forward: _UP4_TAAATTAAAAAGCTCTCTTC
  • References

  • 12297285,11827534,11566026,17385817,11914497,10529095,12519760,15805528,23586998,20697922,21673922,22582280