SubtiBank SubtiBank
hemX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hemX

negative effector of the concentration of [protein|B1413EB525000744BE8E429E760220A13BC4530D|HemA]
locus
BSU_28160
pI
9.28
mw
31.89 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
function
heme biosynthesis
product
regulatory protein, protease?
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • Gene

    Coordinates
    2,876,928 2,877,758

    Expression and Regulation

    Operons

    count
    2
    genes
    [gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]-[gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]-[gene|D266E22E07B849E2AEB0EF232C49A2FE1EA4E02B|hemC]-[gene|33459D4389F85D60311FCE770BBA0ED9802BA342|hemD]-[gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]-[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]
    description
    [Pubmed|1672867]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1672867], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials

    Mutant

  • BKE28160 ([gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCAGTATCAATCATTC, downstream forward: _UP4_TAAACGATGTCCCAAGCAGA
  • BKK28160 ([gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCAGTATCAATCATTC, downstream forward: _UP4_TAAACGATGTCCCAAGCAGA
  • References

  • 10217486,1672867,8012594,11532148