SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


spore lipoprotein
23.24 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
efficient spore [SW|germination]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,548,681 1,549,310

    Phenotypes of a mutant

  • reduced rate of spore [SW|germination] in L-alanine [pubmed|28333204]
  • The protein


  • forespore inner membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|12480901], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|12480901]
  • view in new tab

    Biological materials


  • MGNA-A539 (ylaJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14800 ([gene|8853C1792A12D9F146FFDC407B6DDD82740EDEA8|ylaJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGCGGGTTCCCTCCTT, downstream forward: _UP4_TAAGCTATAGCCTTGCGCTT
  • BKK14800 ([gene|8853C1792A12D9F146FFDC407B6DDD82740EDEA8|ylaJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGCGGGTTCCCTCCTT, downstream forward: _UP4_TAAGCTATAGCCTTGCGCTT
  • References

  • 12107147,12480901,28333204