SubtiBank SubtiBank
yvqJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvqJ

similar to to macrolide-efflux protein
locus
BSU_33140
pI
9.02
mw
45.74 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,399,092 3,400,360

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8840F24C0E159CA1483D9A9164B31E09C8635610|yvqJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B041 (yvqJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1040 NBRP B. subtilis, Japan]
  • BKE33140 ([gene|8840F24C0E159CA1483D9A9164B31E09C8635610|yvqJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCATCAGAGCCCCCCGT, downstream forward: _UP4_TAAAGGGTTTTAAAACGCCA
  • BKK33140 ([gene|8840F24C0E159CA1483D9A9164B31E09C8635610|yvqJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCATCAGAGCCCCCCGT, downstream forward: _UP4_TAAAGGGTTTTAAAACGCCA
  • References

  • 20817675