SubtiBank SubtiBank
pbpH [2018-02-16 12:23:35]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pbpH [2018-02-16 12:23:35]

class B penicillin-binding protein H, required for cell wall synthesis during cell elongation
locus
BSU13980
pI
8.89
mw
76.98 kDa
protein length
685 aa Sequence Blast
gene length
2055 bp Sequence Blast
function
formation of a rod-shaped peptidoglycan cell wall
product
penicillin-binding protein H
essential
no
synonyms
ykuA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.7|Penicillin-binding proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,467,805 → 1,469,862

    The protein

    Catalyzed reaction/ biological activity

  • required for [SW|cell wall synthesis] during cell elongation [Pubmed|12896990]
  • driver of [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] dynamics [Pubmed|21636744,21636745]
  • Protein family

  • transpeptidase family (according to Swiss-Prot)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • localization depends on the availability of peptidoglyan precursors (lipid II) [Pubmed|23895585]
  • Expression and Regulation

    Operons

    genes
    [gene|883DFF72888D280A102E53CC1D69A8B1C7BE2907|pbpH]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B335 (ykuA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1334 NBRP B. subtilis, Japan]
  • BKE13980 (Δ[gene|883DFF72888D280A102E53CC1D69A8B1C7BE2907|pbpH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGATTGCTCTGTTTC, downstream forward: _UP4_TAAAAAACAGGGTGCACAAC
  • BKK13980 (Δ[gene|883DFF72888D280A102E53CC1D69A8B1C7BE2907|pbpH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGATTGCTCTGTTTC, downstream forward: _UP4_TAAAAAACAGGGTGCACAAC
  • References

  • 12896990,20525796,21636744,21636745,20817675,23199363,23895585