SubtiBank SubtiBank
pbpH [2018-02-16 12:36:23]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pbpH [2018-02-16 12:36:23]

class B penicillin-binding protein H, required for [SW|cell wall synthesis ]during cell elongation
76.98 kDa
protein length
685 aa Sequence Blast
gene length
2055 bp Sequence Blast
formation of a rod-shaped peptidoglycan cell wall
penicillin-binding protein H

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Penicillin-binding proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,467,805 → 1,469,862

    The protein

    Catalyzed reaction/ biological activity

  • required for [SW|cell wall synthesis] during cell elongation [Pubmed|12896990]
  • driver of [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] dynamics [Pubmed|21636744,21636745]
  • Protein family

  • transpeptidase family (according to Swiss-Prot)
  • Structure

  • [PDB|2WAF] (Pbp2B from Streptococcus pneumoniae, 31% identity)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • localization depends on the availability of peptidoglyan precursors (lipid II) [Pubmed|23895585]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-B335 (ykuA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13980 (Δ[gene|883DFF72888D280A102E53CC1D69A8B1C7BE2907|pbpH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGATTGCTCTGTTTC, downstream forward: _UP4_TAAAAAACAGGGTGCACAAC
  • BKK13980 (Δ[gene|883DFF72888D280A102E53CC1D69A8B1C7BE2907|pbpH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGATTGCTCTGTTTC, downstream forward: _UP4_TAAAAAACAGGGTGCACAAC
  • GFP fusion

  • 3140 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|883DFF72888D280A102E53CC1D69A8B1C7BE2907|pbpH]::pSG5058 (cat Pxyl-gfpa-[gene|883DFF72888D280A102E53CC1D69A8B1C7BE2907|pbpH]1-827) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [ BGSC]
  • References

  • 12896990,20525796,21636744,21636745,20817675,23199363,23895585,14731276