SubtiBank SubtiBank
yvgJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvgJ

lipoteichoic acid synthesis primase
locus
BSU_33360
pI
5.31
mw
70.57 kDa
protein length
617 aa Sequence Blast
gene length
1854 bp Sequence Blast
function
biosynthesis of lipoteichoic acid
product
lipoteichoic acid synthesis primase
essential
no
synonyms
yvsF

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,422,354 3,424,207

    The protein

    Protein family

  • [SW|LTA synthase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI], [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|YqgS], [protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS]
  • Modification

  • can be phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] in vitro [pubmed|30478337]
  • Structure

  • [PDB|2W5Q] ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS] from S. aureus, corresponds to aa 215 ... 615 of [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ]) [pubmed|19168632]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|yvgJ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B065 (yvgJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1064 NBRP B. subtilis, Japan]
  • BKE33360 ([gene|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|yvgJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATATGACTCCTCACG, downstream forward: _UP4_TGAAAAAATCCCTCTATCAA
  • BKK33360 ([gene|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|yvgJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATATGACTCCTCACG, downstream forward: _UP4_TGAAAAAATCCCTCTATCAA
  • References

    Reviews

  • 21388439,21255102
  • Original publications

  • 19229300,21255105,23103977,19168632,30478337