SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


lipoteichoic acid synthesis primase
70.57 kDa
protein length
617 aa Sequence Blast
gene length
1854 bp Sequence Blast
biosynthesis of lipoteichoic acid
lipoteichoic acid synthesis primase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,422,354 3,424,207

    The protein

    Protein family

  • [SW|LTA synthase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|CCD06F344E3C87E77C3D13883CE2B927F372A84E|YfnI], [protein|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|YqgS], [protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS]
  • Modification

  • can be phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] in vitro [pubmed|30478337]
  • Structure

  • [PDB|2W5Q] ([protein|418900B6DBDF3EF300C930B0C75E31B939F3CE00|LtaS] from S. aureus, corresponds to aa 215 ... 615 of [protein|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|YvgJ]) [pubmed|19168632]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B065 (yvgJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33360 ([gene|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|yvgJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATATGACTCCTCACG, downstream forward: _UP4_TGAAAAAATCCCTCTATCAA
  • BKK33360 ([gene|880C655DC7149F6EDC21BD2CF8F9F2C9FBEB2CDB|yvgJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATATGACTCCTCACG, downstream forward: _UP4_TGAAAAAATCCCTCTATCAA
  • References


  • 21388439,21255102
  • Original publications

  • 19229300,21255105,23103977,19168632,30478337