SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


UDP-glucose:polyglycerol phosphate glucosyltransferase
78.12 kDa
protein length
673 aa Sequence Blast
gene length
2022 bp Sequence Blast
biosynthesis of teichoic acid
UDP-glucose:polyglycerol phosphate glucosyltransferase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of teichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    3,678,399 3,680,420

    Phenotypes of a mutant

  • inactivation of ''tagE'' is advantageous in environments with fluctuating glucose availability [Pubmed|23924781]
  • resistant to phage SPO1 [pubmed|30811056]
  • The protein

    Catalyzed reaction/ biological activity

  • transfer of glucose from UDP-glucose to glycerol phosphate in polymeric form [Pubmed|21558268]
  • Protein family

  • [SW|glycosyltransferase 1 family] (according to UniProt)
  • Modification

  • phosphorylation on Ser-2 [Pubmed|17218307]
  • Structure

  • [PDB|4X7R] (from Staphylococcus aureus, 26% identity) [pubmed|25624472]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7581998], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: repression, [Pubmed|9457886], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|12950927], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • repressed by phosphate ([protein|search|PhoP]) [Pubmed|9457886]
  • view in new tab

    Biological materials


  • 1A981 ( ''tagE''::''erm''), [Pubmed|18487323], available at [ BGSC]
  • BKE35730 ([gene|88028A5F3520CB6DAB014412974EB59CC5D226DD|tagE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTTTACTCCCTTTCG, downstream forward: _UP4_GTCACGGAAATAAAAGAGAG
  • BKK35730 ([gene|88028A5F3520CB6DAB014412974EB59CC5D226DD|tagE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTTTACTCCCTTTCG, downstream forward: _UP4_GTCACGGAAATAAAAGAGAG
  • References


  • 24024634
  • Original publications

  • 9457886,7581998,2507871,17218307,12950927,23924781,21558268,22383849,25624472,30811056