SubtiBank SubtiBank
spoIVFB [2017-12-04 14:14:47]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

spoIVFB [2017-12-04 14:14:47]

intramembrane metalloprotease, processing of pro-sigma-K to active [protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|SigKC]
33.49 kDa
protein length
288 aa Sequence Blast
gene length
864 bp Sequence Blast
processing of pro-sigma-K to active [protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|SigKC]
intramembrane metalloprotease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Proteolysis during sporulation/ germination]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,855,973 → 2,856,839

    The protein

    Catalyzed reaction/ biological activity

  • processing of pro-sigma-K to active [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK] [Pubmed|19805276]
  • Protein family

  • peptidase M50B family (according to Swiss-Prot)
  • [SW|Domains]

  • C-terminal cystathionine-beta-synthase (CBS) domain, this domain binds ATP [Pubmed|19805276]
  • Effectors of protein activity

  • ATP regulates substrate access to the active site and renders cleavage sensitive to the cellular energy level [Pubmed|19805276]
  • [SW|Localization]

  • integral membrane protein [Pubmed|11959848]
  • mother cell membrane [Pubmed|24243021]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,1942049], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,1942049,15383836]
  • additional information

  • the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
  • view in new tab



  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|15699190,1942049,15383836]
  • additional information

  • the domains that inhibits [protein|search|SpoIVFB] is cleaved off by [protein|search|CtpB] (second cleavage) [PubMed|24243021]
  • view in new tab

    Biological materials


  • BKE27970 (Δ[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATCTTTAAGATAAGGTCGA, downstream forward: _UP4_TAAAACTGATTGACAAACGC
  • BKK27970 (Δ[gene|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|spoIVFB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATCTTTAAGATAAGGTCGA, downstream forward: _UP4_TAAAACTGATTGACAAACGC
  • References


  • 20836086,23479438,19189971,24099006
  • Original Publications

  • 11959848,9501233,12940997,1577688,12060714,9078383,1942049,10611287,15383836,16818230,19805276,15699190,23585539,23995631,15087499,24243021,22383849,26953342