SubtiBank SubtiBank
gltC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gltC

transcriptional activator of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon, activates expression of the operon in the absence of arginine
locus
BSU_18460
pI
5.62
mw
33.87 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
function
positive regulation of the glutamate synthase operon ([gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB])
product
transcriptional regulator ([SW|LysR family])
essential
No
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,014,779 2,015,681

    Phenotypes of a mutant

  • ''gltC'' mutants are auxotrophic for glutamate, this can be suppressed by the [gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]24 mutation or by amplification of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] genomic region [pubmed|9023181,28294562]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription activation of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon [Pubmed|2548995]
  • Protein family

  • [SW|LysR family] (according to UniProt) [Pubmed|2548995]
  • [SW|Domains]

  • DNA-binding helix-turn-helix motif: AA 18 ... 37
  • Effectors of protein activity

  • 2-oxoglutarate stimulates transcription activation, glutamate inhibits transcription activation [Pubmed|17134717]
  • Structure

  • [PDB|2H99] (from Acinetobacter baylyi, corresponds to aa 1 - 245, 35% identity) [pubmed|19400783]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000048 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2548995], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]: auto-repression, [Pubmed|2548995], in [regulon|87BCAE725B02860156D50E1783F6DB68510C811E|GltC regulon]
  • regulation

  • autoregulation by GltC [Pubmed|2548995]
  • view in new tab

    Biological materials

    Mutant

  • GP344 (erm), (available in [SW|Jörg Stülke]'s lab)
  • GP738 (gltC::Tn10, spc), (available in [SW|Jörg Stülke]'s lab)
  • GP1904 (''gltC''::''aphA3''), (available in [SW|Jörg Stülke]'s lab) [pubmed|28294562]
  • BKE18460 ([gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACATCCAT, downstream forward: _UP4_TAAAAAAAATGAACCCGAGC
  • BKK18460 ([gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACATCCAT, downstream forward: _UP4_TAAAAAAAATGAACCCGAGC
  • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP903, available in [SW|Jörg Stülke]'s lab
  • for expression, purification in ''E. coli'' with C-terminal Strep-tag, in pET3C: pGP951, available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • [SW|Fabian Commichau] Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
  • References

    Reviews

  • 20408793,22625175
  • Original Publications

  • 7559360,15150225,2548995,17183217,17608797,17134717,14523131,20630473,25711804,28294562,19400783