SubtiBank SubtiBank
gltC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gltC

transcriptional activator of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon, activates expression of the operon in the absence of arginine
locus
BSU18460
pI
5.62
mw
33.87 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
function
positive regulation of the glutamate synthase operon ([gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB])
product
transcriptional regulator ([SW|LysR family])
essential
No
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.1|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,014,779 2,015,681

    Phenotypes of a mutant

  • ''gltC'' mutants are auxotrophic for glutamate, this can be suppressed by the [gene|544CE1370BE7444F361F62808E320CE97C3C2F93|gltR]24 mutation or by amplification of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] genomic region [pubmed|9023181,28294562]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription activation of the [gene|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|gltA]-[gene|AA07CC52B2DD48ACC9D3375E9D531CB1ACBE485A|gltB] operon [Pubmed|2548995]
  • Protein family

  • [SW|LysR family] [Pubmed|2548995]
  • [SW|Domains]

  • DNA-binding helix-turn-helix motif: AA 18 ... 37
  • Effectors of protein activity

  • 2-oxoglutarate stimulates transcription activation, glutamate inhibits transcription activation [Pubmed|17134717]
  • Structure

  • [PDB|2H99] (from Acinetobacter baylyi, corresponds to aa 1 - 245, 35% identity) [pubmed|19400783]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000048 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2548995], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|87BCAE725B02860156D50E1783F6DB68510C811E|GltC]: auto-repression, [Pubmed|2548995], in [regulon|87BCAE725B02860156D50E1783F6DB68510C811E|GltC regulon]
  • regulation

  • autoregulation by GltC [Pubmed|2548995]
  • view in new tab

    Biological materials

    Mutant

  • GP344 (erm), (available in [SW|Jörg Stülke]'s lab)
  • GP738 (gltC::Tn10, spc), (available in [SW|Jörg Stülke]'s lab)
  • GP1904 (''gltC''::''aphA3''), (available in [SW|Jörg Stülke]'s lab) [pubmed|28294562]
  • BKE18460 ([gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACATCCAT, downstream forward: _UP4_TAAAAAAAATGAACCCGAGC
  • BKK18460 ([gene|87BCAE725B02860156D50E1783F6DB68510C811E|gltC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACATCCAT, downstream forward: _UP4_TAAAAAAAATGAACCCGAGC
  • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP903, available in [SW|Jörg Stülke]'s lab
  • for expression, purification in ''E. coli'' with C-terminal Strep-tag, in pET3C: pGP951, available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • [SW|Fabian Commichau] Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
  • References

    Reviews

  • 20408793,22625175
  • Original Publications

  • 7559360,15150225,2548995,17183217,17608797,17134717,14523131,20630473,25711804,28294562,19400783