SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


polygalacturonan and rhamnogalacturonan [SW|ABC transporter] (permease)
31.54 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast
uptake of polygalacturonan and rhamnogalacturonan
polygalacturonan and rhamnogalacturonan [SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,087,321 3,088,181

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|CysTW subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0A7FF3E2747598AE0EE39183E8827879C4B11A80|LplC]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 69-271) (according to UniProt)
  • Structure

  • [PDB|4TQU] (from Sphingomonas sp., 36% identity) [pubmed|26235029]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation


    view in new tab

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • MGNA-B536 (ytcP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30170 ([gene|87B212C8C61483DF2874762A3B77111616C616A5|ytcP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGTGAATGTGCGATAGCTC, downstream forward: _UP4_TAAAGAAATATGAAACGGAG
  • BKK30170 ([gene|87B212C8C61483DF2874762A3B77111616C616A5|ytcP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGTGAATGTGCGATAGCTC, downstream forward: _UP4_TAAAGAAATATGAAACGGAG
  • References

  • 10092453,22383849,26235029,29240795