SubtiBank SubtiBank
yusQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yusQ

similar to acyloate catabolism
locus
BSU_32890
pI
5.47
mw
15.11 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,376,617 3,377,000

    The protein

    Protein family

  • [SW|4-oxalocrotonate tautomerase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|1F6B2CF88F5C6498A035FA0465136EF9D0BF93BC|YodA]
  • Structure

  • [PDB|2AAG] (from Pseudomonas pavonaceae, 27% identity) [pubmed|16274229]
  • Expression and Regulation

    Operons

    genes
    [gene|652A1CC7F6D33E2C9032E557FAF34B5A828CD441|yusS]-[gene|6A16E8F87DA1D5835DFCD5803B11D0E004E6F4FE|yusR]-[gene|877C25D538BAF1132290BAF7FBB2E7921B51266A|yusQ]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B596 (yusQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1595 NBRP B. subtilis, Japan]
  • BKE32890 ([gene|877C25D538BAF1132290BAF7FBB2E7921B51266A|yusQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGGCATCTCCCCGCATCCCT, downstream forward: _UP4_TAAAAAACCCCGCGGATTGA
  • BKK32890 ([gene|877C25D538BAF1132290BAF7FBB2E7921B51266A|yusQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGGCATCTCCCCGCATCCCT, downstream forward: _UP4_TAAAAAACCCCGCGGATTGA
  • References

    Research papers

  • 16274229