SubtiBank SubtiBank
tuaC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tuaC

sugar transferase
locus
BSU_35590
pI
9.75
mw
43.12 kDa
protein length
389 aa Sequence Blast
gene length
1170 bp Sequence Blast
function
biosynthesis of teichuronic acid
product
sugar transferase
essential
no
synonyms
yvhC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.5|Biosynthesis of teichuronic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.4|Biosynthesis of teichuronic acid]
  • Gene

    Coordinates
    3,655,586 3,656,755

    The protein

    Protein family

  • [SW|glycosyltransferase 1 family] (according to UniProt)
  • [SW|Glycosyltransferase 4 subfamily] (according to UniProt)
  • Structure

  • [PDB|3C48] (from Corynebacterium glutamicum, 27% identity) [pubmed|18390549]
  • Expression and Regulation

    Operons

    genes
    [gene|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]-[gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]-[gene|54F96DE549F78E6C1580949A21C84B27AF26C4C6|tuaB]-[gene|873EE7A8C9BBFC6E96B0957B450BA665E3C9222D|tuaC]-[gene|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD]-[gene|B89FA71C2924CC0690224AFBFA06DB0FF0D97C0A|tuaE]-[gene|6F0FA23892BB1829174F66C464149DB428A8DE18|tuaF]-[gene|6E4F2BA67FF58085D462F6A6FB6497BDF600FCF6|tuaG]-[gene|737B37DA0DA1642AD5C4A824228BFED55FF0652A|tuaH]
    description
    [Pubmed|10048024]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10048024], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9611818,10627039], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE35590 ([gene|873EE7A8C9BBFC6E96B0957B450BA665E3C9222D|tuaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATGACAAACGTCCTTT, downstream forward: _UP4_TAATCGTAAGACACTGCGAC
  • BKK35590 ([gene|873EE7A8C9BBFC6E96B0957B450BA665E3C9222D|tuaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATGACAAACGTCCTTT, downstream forward: _UP4_TAATCGTAAGACACTGCGAC
  • References

  • 9611818,10048024,10627039,18390549