SubtiBank SubtiBank
rny [2019-02-04 12:11:10]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

rny [2019-02-04 12:11:10]

RNase Y, 5 end sensitive endoribonuclease, involved in the degradation/ processing of mRNA, part of the putative [SW|RNA degradosome]
58.75 kDa
protein length
520 aa Sequence Blast
gene length
1563 bp Sequence Blast
RNA processing and degradation
RNase Y

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW|Endoribonucleases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,767,310 1,768,872

    Phenotypes of a mutant

  • transcription profile resulting from [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] depletion: [ GEO] [Pubmed|21815947]
  • defect in spore [SW|germination] [Pubmed|22209493]
  • the mutant is strongly impaired in [SW|sporulation], [SW|genetic competence] and many other phenotypes [Pubmed|23504012]
  • it is not possible to construct a [gene|3EB289D0F58A58C693AB588798EE66A731341999|rnjA] [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] double mutant [Pubmed|23504012]
  • The protein

    Catalyzed reaction/ biological activity

  • processing, maturation and degradation of mRNAs, see [SW|RNase Y targets]
  • [SW|RNase] Y cleaves [protein|search|S-box] [gene|C245476CE35028167510F67153F392D91447553F|mgtE riboswitch] RNAs ''in vivo'' and ''in vitro'' [Pubmed|19779461]
  • preference for 5' monophosphorylated substrate ''in vitro'' [Pubmed|19779461]
  • endonucleolytic cleavage [Pubmed|19779461]
  • required for the processing of the ''[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]'' operon mRNA [Pubmed|19193632]
  • cleavage activity appears sensitive to downstream secondary structure [Pubmed|19779461]
  • [SW|RNase] Y initiates the degradation of ''[gene|EC5D3ECF361C7CDEB606284F5E17243CD926989E|rpsO]'' mRNA [Pubmed|20418391]
  • [SW|RNase] Y is responsible for the degradation of [SW|23S rRNA], [SW|16S rRNA], and mRNAs in aging spores [Pubmed|22209493]
  • [SW|RNase] Y cleaves the leader of the ''[gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO]'' mRNA at a stem-loop structure [Pubmed|24163346]
  • 3' end maturation of [gene|57A79AAF00243B5E058FA901D43AA7B55CA33F63|RNase P RNA]]] and [gene|097C817A5A3E31F73F6ABC4AA95852A64E43A057|scRNA]]] [Pubmed|25402410]
  • Protein family

  • Member of the HD superfamily of metal-dependent phosphohydrolases; 2',3' cyclic nucleotide phosphodiesterase family (according to Swiss-Prot)
  • [SW|Domains]

  • transmembrane domain (aa 524) [Pubmed|21803996]
  • coiled-coiled domain (may form a leucine zipper) (aa 30-150) [Pubmed|21803996]
  • [SW|KH domain] (aa 210280) [Pubmed|21803996,18422648]
  • [SW|HD domain] (aa 330430) [Pubmed|21803996,9868367]
  • C-terminal domain (aa 430-520) [Pubmed|21803996]
  • [SW|Cofactors]

  • requires Mg 2, which can be replaced by Zn 2 or Mn 2 ions, [Pubmed|19779461]
  • Effectors of protein activity

  • appears sensitive to downstream secondary structure [Pubmed|19779461]
  • interaction of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] with the complex of [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] stimulates the degradation and maturation of several polycistronic mRNAs [Pubmed|29794222,26434553]
  • Structure

  • [PDB|6F7T] (the N-teminal part, aa 1 ... 218) [pubmed|30447990]
  • [SW|Localization]

  • cell membrane, single-pass membrane protein [Pubmed|18763711,17005971,19820159,27708634]
  • forms foci at the site of septation [Pubmed|23060960]
  • Additional information

  • required for the processing of the ''[gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA]'' operon mRNA
  • Expression and Regulation




  • constitutive
  • additional information

  • the [SW|transcription] terminator between ''[SW|rny]'' and ''[SW|ymdB]'' is strong and [SW|NusA]-independent [ Reference]
  • view in new tab



  • constitutive
  • additional information

  • the [SW|transcription] terminator between ''[SW|rny]'' and ''[SW|ymdB]'' is strong and [SW|NusA]-independent [ Reference]
  • view in new tab

    Biological materials


  • 4043 (''rny'' under p-spac control, ''cat''), GP193 (''rny'' under p-xyl control, ''cat''), both available in [SW|Jörg Stülke]'s lab
  • SSB447 (rny under P-spac control, ''erm'') available in [SW|Putzer] lab
  • GP2501 ([gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]::''spc''), available in [SW|Jörg Stülke]'s lab
  • GP2524 ([gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • BKE16960 ([gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTTCACCTCCTCTTG, downstream forward: _UP4_TAAAGTGATGCGCTAAGCAT
  • BKK16960 ([gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTTTCACCTCCTCTTG, downstream forward: _UP4_TAAAGTGATGCGCTAAGCAT
  • Expression vectors

  • N-terminal Strep-tag, expression in ''E. coli'', in [SW|pGP172]: pGP441, available in [SW|Jörg Stülke]'s lab
  • pGP2813: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
  • N-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP380]: pGP775, available in [SW|Jörg Stülke]'s lab
  • C-terminal Strep-tag, for [SW|SPINE], expression in ''B. subtilis'', in [SW|pGP382]: pGP1852, available in [SW|Jörg Stülke]'s lab
  • Expression of RNase Y missing the N-terminal transmembrane domain (25aa) as an intein fusion in E. coli (no tag left in the purified protein) available in the [SW|Putzer] lab
  • wild type ''rny'', expression in ''B. subtilis'', in [SW|pBQ200]: pGP1201, available in [SW|Jörg Stülke]'s lab
  • there is also a series of domain constructs present in [SW|pBQ200], all available in [SW|Jörg Stülke]'s lab
  • chromosomal expression of Rny-Strep, ''spc'': GP1033, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP459 (in [protein|search|pAC7]), available in [SW|Jrg Stlke]'s lab
  • GFP fusion

  • B. subtilis 3569 (amyE:: (p-xyl rny-gfpmut1-spc)), available in [SW|Errington] lab
  • pGP1368 for chromosomal expression of rny-YFP, available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • FLAG-tag construct

  • GP1030 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|van Dijl] and in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Ciaran Condon], IBPC Paris, France [ Homepage]
  • [SW|Harald Putzer], IBPC Paris, France [ Homepage]
  • [SW|Jörg Stülke], University of Gttingen, Germany [ Homepage]
  • References


  • 21957024,22568516,24064983,9868367,18422648,25292357,29314657,29651979
  • Original publications

  • 21862575,22198292,22209493,22412379,23060960,23326572,21908660,21856853,21815947,24163346,18763711,19193632,17005971,19779461,19820159,20418391,20525796,20572937,21803996,21843271,23504012,25402410,26473962,26802042,26797123,26819068,26940229,21803996,27708634,27449348,26434553,28542621,28977557,29794222,30447990,30502948
  • Publications on homologs from other organisms

  • 17951247,20385762,15853881,26473962