SubtiBank SubtiBank
yjbH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjbH

adaptor protein for [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]-catalyzed [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] degradation, confers resistance against nitrosating agents
locus
BSU_11550
pI
5.21
mw
31.33 kDa
protein length
299 aa Sequence Blast
gene length
900 bp Sequence Blast
function
stimulation of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] degradation
product
adaptor protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    1,233,614 1,234,513

    Phenotypes of a mutant

  • increased thermotolerance due to increased stabiliy of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] and thus increased expression of ''[gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA]'' [Pubmed|24417481]
  • The protein

    Catalyzed reaction/ biological activity

  • adaptor protein for [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]-catalyzed [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] degradation [Pubmed|19074380]
  • Protein family

  • UPF0413 family (single member, according to UniProt)
  • [SW|Cofactors]

  • contains Zn atoms (coordinated by the N-terminal His-rich region) [Pubmed|19074380]
  • Effectors of protein activity

  • [protein|87124945A1CBF7990856FBEB9EAD25096DAC0868|YjbH] aggregates under stress conditions, resulting in the inability to bind to [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx], and therefore in stabilization of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] [Pubmed|25353645]
  • Zn atom is released upon treatment with strong oxidants [Pubmed|19074380]
  • interaction with [protein|5EC57A51EF2DC48070615653B7A3C1007CFEE01D|YirB] inhibits the formation of a complex with [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] [Pubmed|21378193]
  • Structure

  • [PDB|6GHB] (oxidized Geobacillus kaustophilus protein complexed with B. subtilis Spx) [Pubmed|30982633]
  • [PDB|6GHO] (Geobacillus kaustophilus protein complexed with B. subtilis Spx) [Pubmed|30982633]
  • [SW|Localization]

  • cytosolic protein
  • Expression and Regulation

    Operons

    genes
    [gene|948BD57CC45915C7CDDB8EF168287533FC514B7C|yjbI]-[gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]
    description
    [Pubmed|17293416]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|29271514], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by cell wall stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|29271514]
  • additional information

  • A [protein|search|ncRNA] is predicted between [gene|138DC46C976BAA18893B70DF040BA1BB2FA0A77C|yizD] and [gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • GP2645 ([gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]::''erm''), available in [SW|Jörg Stülke]'s lab
  • BKE11550 (''[gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE11550 ([gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTATAGCTCATGCTGATAGT, downstream forward: _UP4_TAGCCGCAGGCGTGCATATG
  • BKK11550 ([gene|87124945A1CBF7990856FBEB9EAD25096DAC0868|yjbH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTATAGCTCATGCTGATAGT, downstream forward: _UP4_TAGCCGCAGGCGTGCATATG
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Peter Zuber], Oregon Health and Science University, USA
  • [http://www.ogi.edu/people/dsp_person.cfm?person_id=411D6801-2A56-D16D-58A06B4480EDB9C7 Homepage]
  • [SW|Claes von Wachenfeldt], Lund University, Sweden [http://aron.ldc.lu.se/kundwebb/cellorg/mibiol/research/wachen/index.htm Homepage]
  • References

    Reviews

  • 23375660,23479438,19609260,28748186
  • Original Publications

  • 17293416,19074380,17908206,20525796,21378193,21947404,24417481,24942655,25353645,27191337,29271514,30982633